Review



puromycin resistance gene sequences  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    TaKaRa puromycin resistance gene sequences
    Puromycin Resistance Gene Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 3496 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puromycin resistance gene sequences/product/TaKaRa
    Average 97 stars, based on 3496 article reviews
    puromycin resistance gene sequences - by Bioz Stars, 2026-02
    97/100 stars

    Images



    Similar Products

    97
    TaKaRa puromycin resistance gene sequences
    Puromycin Resistance Gene Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puromycin resistance gene sequences/product/TaKaRa
    Average 97 stars, based on 1 article reviews
    puromycin resistance gene sequences - by Bioz Stars, 2026-02
    97/100 stars
      Buy from Supplier

    98
    AMS Biotechnology lentiviruses carrying luciferase gfp sequences along puromycin resistance gene
    Lentiviruses Carrying Luciferase Gfp Sequences Along Puromycin Resistance Gene, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviruses carrying luciferase gfp sequences along puromycin resistance gene/product/AMS Biotechnology
    Average 98 stars, based on 1 article reviews
    lentiviruses carrying luciferase gfp sequences along puromycin resistance gene - by Bioz Stars, 2026-02
    98/100 stars
      Buy from Supplier

    97
    TaKaRa sv40 early promotor puromycin resistance gene polyadenylation signal sequence
    Sv40 Early Promotor Puromycin Resistance Gene Polyadenylation Signal Sequence, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sv40 early promotor puromycin resistance gene polyadenylation signal sequence/product/TaKaRa
    Average 97 stars, based on 1 article reviews
    sv40 early promotor puromycin resistance gene polyadenylation signal sequence - by Bioz Stars, 2026-02
    97/100 stars
      Buy from Supplier

    90
    VectorBuilder GmbH lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene
    Lentivirus: Scrambled And Tβriii Targeted Lentiviral Shrna Expression Vectors With Predesigned Sequences Including Puromycin Resistant Gene, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene - by Bioz Stars, 2026-02
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene
    Plasmid Containing The Mouse Opn5 Grna Sequence (Gctcaggtgcatagtccccc) And A Puromycin Resistance Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene - by Bioz Stars, 2026-02
    90/100 stars
      Buy from Supplier

    97
    TaKaRa puromycin resistance gene sequence
    Puromycin Resistance Gene Sequence, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puromycin resistance gene sequence/product/TaKaRa
    Average 97 stars, based on 1 article reviews
    puromycin resistance gene sequence - by Bioz Stars, 2026-02
    97/100 stars
      Buy from Supplier

    90
    Millipore the plko.1 vector system with a puromycin resistance gene containing one shrna sequence for caldag-gefi
    Static adhesion on immobilized VCAM1 in the presence of (A) wortmannin (10 nM, 30 minutes) or (B) LY294002 (25 μM; 3 hours) in 32D JAK2-V617F and JAK2-WT cells. Minus symbol (–) indicates DMSO control. Representative Western blots (of 3 independent experiments) of phospho-Akt and Akt demonstrate the efficient blockade of signaling. (C) Inhibition of Rap1 activation by LY294002 treatment (25 μM; 3 hours) in 32D JAK2-V617F cells. Lower panel shows quantitative analysis of Rap1 activation given as fold compared with controls and corrected for loading variations using total Rap1; minus symbol (–) indicates DMSO control. (D) Rap1 pull-down and static adhesion on immobilized VCAM1 in the absence and presence of Akt inhibitor VIII treatment (0.5 μM; 4 hours) in 32D JAK2-V617F and JAK2-WT cells; minus symbol (–) indicates DMSO control. Representative Western blots (of 3 independent experiments) of phospho-Akt and Akt demonstrate the efficient blockade of signaling. (E) Static adhesion of 32D JAK2-V617F and JAK2-WT cells on immobilized VCAM1 in the absence and presence of BAPTA/AM (10 μM; 1 hour). (F) Static adhesion on immobilized VCAM1 of 32D JAK2-V617F cells transfected with scrambled (scr) or <t>CalDAG-GEFI</t> shRNA. (G) Rap1 pull-down after knockdown of CalDAG-GEFI results in reduced Rap1 activity. Data are shown as mean ± SEM. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 (1-way ANOVA with Bonferroni’s post test and unpaired, 2-tailed Student’s t test). Three independent experiments were performed each.
    The Plko.1 Vector System With A Puromycin Resistance Gene Containing One Shrna Sequence For Caldag Gefi, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/the plko.1 vector system with a puromycin resistance gene containing one shrna sequence for caldag-gefi/product/Millipore
    Average 90 stars, based on 1 article reviews
    the plko.1 vector system with a puromycin resistance gene containing one shrna sequence for caldag-gefi - by Bioz Stars, 2026-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Static adhesion on immobilized VCAM1 in the presence of (A) wortmannin (10 nM, 30 minutes) or (B) LY294002 (25 μM; 3 hours) in 32D JAK2-V617F and JAK2-WT cells. Minus symbol (–) indicates DMSO control. Representative Western blots (of 3 independent experiments) of phospho-Akt and Akt demonstrate the efficient blockade of signaling. (C) Inhibition of Rap1 activation by LY294002 treatment (25 μM; 3 hours) in 32D JAK2-V617F cells. Lower panel shows quantitative analysis of Rap1 activation given as fold compared with controls and corrected for loading variations using total Rap1; minus symbol (–) indicates DMSO control. (D) Rap1 pull-down and static adhesion on immobilized VCAM1 in the absence and presence of Akt inhibitor VIII treatment (0.5 μM; 4 hours) in 32D JAK2-V617F and JAK2-WT cells; minus symbol (–) indicates DMSO control. Representative Western blots (of 3 independent experiments) of phospho-Akt and Akt demonstrate the efficient blockade of signaling. (E) Static adhesion of 32D JAK2-V617F and JAK2-WT cells on immobilized VCAM1 in the absence and presence of BAPTA/AM (10 μM; 1 hour). (F) Static adhesion on immobilized VCAM1 of 32D JAK2-V617F cells transfected with scrambled (scr) or CalDAG-GEFI shRNA. (G) Rap1 pull-down after knockdown of CalDAG-GEFI results in reduced Rap1 activity. Data are shown as mean ± SEM. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 (1-way ANOVA with Bonferroni’s post test and unpaired, 2-tailed Student’s t test). Three independent experiments were performed each.

    Journal: The Journal of Clinical Investigation

    Article Title: JAK2-V617F promotes venous thrombosis through β 1 /β 2 integrin activation

    doi: 10.1172/JCI90312

    Figure Lengend Snippet: Static adhesion on immobilized VCAM1 in the presence of (A) wortmannin (10 nM, 30 minutes) or (B) LY294002 (25 μM; 3 hours) in 32D JAK2-V617F and JAK2-WT cells. Minus symbol (–) indicates DMSO control. Representative Western blots (of 3 independent experiments) of phospho-Akt and Akt demonstrate the efficient blockade of signaling. (C) Inhibition of Rap1 activation by LY294002 treatment (25 μM; 3 hours) in 32D JAK2-V617F cells. Lower panel shows quantitative analysis of Rap1 activation given as fold compared with controls and corrected for loading variations using total Rap1; minus symbol (–) indicates DMSO control. (D) Rap1 pull-down and static adhesion on immobilized VCAM1 in the absence and presence of Akt inhibitor VIII treatment (0.5 μM; 4 hours) in 32D JAK2-V617F and JAK2-WT cells; minus symbol (–) indicates DMSO control. Representative Western blots (of 3 independent experiments) of phospho-Akt and Akt demonstrate the efficient blockade of signaling. (E) Static adhesion of 32D JAK2-V617F and JAK2-WT cells on immobilized VCAM1 in the absence and presence of BAPTA/AM (10 μM; 1 hour). (F) Static adhesion on immobilized VCAM1 of 32D JAK2-V617F cells transfected with scrambled (scr) or CalDAG-GEFI shRNA. (G) Rap1 pull-down after knockdown of CalDAG-GEFI results in reduced Rap1 activity. Data are shown as mean ± SEM. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 (1-way ANOVA with Bonferroni’s post test and unpaired, 2-tailed Student’s t test). Three independent experiments were performed each.

    Article Snippet: For knockdown of CalDAG-GEFI, the pLKO.1 vector system with a puromycin resistance gene containing one shRNA sequence for CalDAG-GEFI (Sigma-Aldrich) was used.

    Techniques: Western Blot, Inhibition, Activation Assay, Transfection, shRNA, Activity Assay